Table 1.

Primer sequences

PrimerDirectionSequences
Cyclophilin Fwd5′‐ GGATTCATGTGCCAGGGTGG‐3′
Rev5′‐ CACATGCTTGCCATCCAGCC ‐3′
Fst Fwd5΄‐ CCGCCACACTGGATATCTTC ‐3΄
Rev5΄‐ CCGCCACACTGGATATCTTC ‐3΄
Mstn Fwd5′‐TAACCTTCCCAGGACCAGGA‐3′
Rev5′‐CACTCTCCAGAGCAGTAATT‐3′
MyoD Fwd5′‐CGGCTACCCAAGGTGGAGAT‐3′
Rev5′‐GAGCACTCGGCTAATCGAAC‐3′
Pax‐7 Fwd5′‐CCGTGTTTCTCATGGTTGTG‐3′
Rev5′‐GAGCACTCGGCTAATCGAAC‐3′
Mstn (Fig. 5A and C)Fwd5′‐TAACCTTCCCAGGACCAGGAG‐3′
Rev5′‐GCAGTCAAGCCCAAAGTCTC‐3′
Mstn‐propeptide Fwd5′‐TGACAGCAGTGATGGCTCTT‐3′
Rev5′‐CCGTCTTTCATGGGTTTGAT‐3′