Table 1. mRNA sequences
GeneSequence
CHMP2A (forward)CGCTATGTGCGCAAGTTTGT
CHMP2A (reverse)GGGGCAACTTCAGCTGTCTG
C1orf43 (forward)CTATGGGACAGGGGTCTTTGG
C1orf43 (reverse)TTTGGCTGCTGACTGGTGAT
EMC7 (forward)GGGCTGGACAGACTTTCTAATG
EMC7 (reverse)CTCCATTTCCCGTCTCATGTCAG
SESN1 (forward)TTTCGTGTCCAGGACTATTGC
SESN1 (reverse)ACTGTCCCACATCTGGATAAAGG
SESN2 (forward)CAACCTCTTCTGGAGGCACTT
SESN2 (reverse)CCTGCTCAGGAGTCAGGTCA
SESN3 (forward)CAGGCAGCAACTTTGGGATTGT
SESN3 (reverse)AGACGCCTCTTCATCTTCCCTT
p62 (forward)GAATCAGCTTCTGGTCCATCGG
p62 (reverse)GCTTCTTTTCCCTCCGTGCT
  • Forward and reverse sequences of analyzed genes.