Table 1. Primer sequences for the genes analyzed using qPCR with optimized conditions including annealing temperature and primer concentration. Key functions are also listed for each gene. F: forward; R: reverse
GeneMain functionSequenceAnnealing temperature (°C)Primer concentration (nmol L−1)
krt78 Keratin proteinF: 5′‐TGGTCCTCAAGAAGGATGTGG‐3′60350
R: 5′‐GATGCTGCTGAAGTCCAGGT‐3′350
slc2a5 Glucose transportF: 5′‐TATCGGATCCCTCCTGGTCG‐3′60350
R: 5′‐CACGTTGGAAGATACACCTGC‐3′350
rilpl2 Lysosome morphologyF: 5′‐GTGCTACAAGAGTGGCCTGAT‐3′60300
R: 5′‐AGCCTTACTTGTGGCCTTGG‐3′300
gpr128 Cell signalingF: 5′‐CTGGAAACCCTGGAAAAGCA‐3′60300
R: 5′‐ATGGCAACTTTCTTTGCCTCA‐3′300
Tuba1a Housekeeping geneF: 5′‐GAAGCAGCAACCATGCGTGA‐3′60300
R: 5′‐ATCTCCTCCCCCAATGGTCTT‐3′300
let‐7a Housekeeping geneF: 5′‐AGCAGTGAGGTAGTAGGT‐3′60250
R: 5′‐ CCAGTTTTTTTTTTTTTTTAACTATACA‐3′
leg‐7g ApoptosisF: 5′‐GCAGTGAGGTAGTAGTTTGTA‐3′60250
R: 5′‐GTCCAGTTTTTTTTTTTTTTTAACTG‐3′
miR‐99a Keratinocyte differentiationF: 5′‐AGAACCCGTAGATCCGA‐3′60250
R: 5′‐CAGTTTTTTTTTTTTTTTCACAAGA‐3′
RT primerN/A5′‐CAGGTCCAGTTTTTTTTTTTTTTTVN– 3′