Table 1. Employed primers and quantitative PCR (qPCR) cycling parameters
TargetPrimersCycle conditionsProduct
AromataseF: 5′ TTTACCCTTGAAAACTTTGAGAAGAAC3′One cycle of 10 min at 95°C followed by 45 cycles of 15 sec at 95°C, 30 sec at 55°C, 30 sec at 60°C, 30 sec at 72°C122 bp
R: 5′GTAACCAGGACAACTTTCATCATCAC3′
GnRHF: 5′CAGCACTGGTCCTATGGGTTGCG3′One cycle of 10 min 95°C followed by 40 cycles of 15 sec at 95°C, 30 sec at 60°C, 30 sec at 72°C189 bp
R: 5′TTCCTCTTCAATCAGACGTTCC3′
GAPDHF: 5′CCAGAACATCATCCCTGCAT3′One cycle of 10 min at 95°C followed by 40 cycles of 15 sec at 95°C, 30 sec at 60°C, 30 sec at 72°C67 bp
R: 5′GTTCAGCTCTGGGATGACCTT3′
  • Aromatase primers sequences were previously used by Galmiche et al. (2006). GnRH primers were employed in vizcacha by Charif et al. (2016) and GAPDH primers by Gonzalez et al. (2012). Product = Amplified product length. bp, base pairs.