Table 1. List of primers used for quantitative RT‐PCR analyses
GeneForward primer (5′‐3′)Reverse primer (5′‐3′)
PDCD4ATGAGACTGTGGTTCTGCCCTCCCTTAACATCTCCGCGAC
MyogeninCCCAGTGAATGCAACTCCCACGAGCAAATGATCTCCTGGGT
Myosin heavy chain‐1GAGTCCCAGGTCAACAAGCTGGTGCCTCTCTTCGGTCATTC
HPRTCTTCCTCCTCAGACCGCTTTTATCACTAATCACGACGCTGG