Table 1. RT‐qPCR primers and probes
mRNA primersSequence (5′ to 3′)Universal Probe No.Accession no.
Pgc1aForwardtgtggaactctctggaactgc63 NM_008904.2
Reverseagggttatcttggttggcttta
PparaForwardccgagggctctgtcatca11 NM_011144.6
Reversegggcagctgactgaggaa
PpardForwardatgggggaccagaacacac11 NM_011145.3
Reverseggaggaattctgggagaggt
CycsForwardaacgttcgtggtgttgacc104 NM_007808.4
Reversettatgcttgcctcccttttc
Pdk4Forwardcgcttagtgaacactccttcg22 NM_013743.2
Reversecttctgggctcttctcatgg
Oxct1Forwardcaggcaatgtgattttcagg22 NM_024188.6
Reversegcaaatgagccaatgtctacaa
Cd36Forwardtttcctctgacatttgcaggt11NM_001159558.1
Reversegattctggaggggtgatgc
Fatp1Forwardcttcctaaggctgccattgt49 NM_011977.3
Reverseggcagtcatagagcacatcg
Cpt1bForwardccatcattgggcacctct104 NM_009948.2
Reversegtctccgtgtagcccaggt
LplForwardtggataagcgactcctacttcag22 NM_008509.2
Reversetccctagcacagaagatgacc
Myh7Forwardtgcattgacctcatcgagaa63 NM_080728.2
Reversegtcatgtctgtggccttgg
Myh4Forwardtgcttacgtcagtcaaggtga104 NM_010855.2
Reverseaatcccaggatatcaacagca
Myh2Forwardtcttctctggggcacaaact22NM_001039545.2
Reversecccttcttcttggcaccttt
Glut4Forwardtcgtcattggcattctggt104 NM_009204.2
Reverseagcagtggccacagggta
VegfaForwardactggaccctggctttactg22NM_001025250.3
Reversetctgctctccttctgtcgtg
Mct1Forwardatgctgccctgtcctcct49 NM_009196.3
Reverseccacaagcccagtacgtgtat
Mct4Forwardctcatagatctttatgactggacagg11 NM_146136.1
Reversetgtttgattggctgtggatg
HprtForwardcctcctcagaccgcttttt95 NM_013556.2
Reverseaacctggttcatcatcgctaa