Table 1. Summary of qRT‐PCR oligonucleotide primers used in measuring mRNA expression of mitochondrial biogenesis, dynamics, and electron transport chains
GeneDNA sequence (5′‐3′)PCR product size
Mitochondrial biogenesis
Ppargc1a Forward Primer GCAGTCGCAACATGCTCAAG83
Reverse Primer GGGAACCCTTGGGGTCATTT
Tfam Forward Primer TCCACAGAACAGCTACCCAA84
Reverse Primer CCACAGGGCTGCAATTTTCC
Nrf1 Forward Primer AGAAACGGAAACGGCCTCAT96
Reverse Primer CATCCAACGTGGCTCTGAGT
Nrf2 Forward Primer ATGGAGCAAGTTTGGCAGGA96
Reverse Primer GCTGGGAACAGCGGTAGTAT
Mitochondrial dynamics
Drp1 Forward Primer ATGCCAGCAAGTCCACAGAA86
Reverse Primer TGTTCTCGGGCAGACAGTTT
Fis1 Forward Primer CAAAGAGGAACAGCGGGACT95
Reverse Primer ACAGCCCTCGCACATACTTT
Mfn1 Forward Primer GCAGACAGCACATGGAGAGA83
Reverse Primer GATCCGATTCCGAGCTTCCG
Mfn2 Forward Primer TGCACCGCCATATAGAGGAAG78
Reverse Primer TCTGCAGTGAACTGGCAATG
Opa1 Forward Primer ACCTTGCCAGTTTAGCTCCC82
Reverse Primer TTGGGACCTGCAGTGAAGAA
CypD Forward Primer AGATGTCAAATTGGCAGGGGG91
Reverse Primer TGCGCTTTTCGGTATAGTGCT
Mitochondrial‐encoded Electron Transport Chain Genes
ND1 – CIForward Primer ATTACTTCTGCCAGCCTGACC70
Reverse Primer GGCCCGGTTTGTTTCTGCTA
ND5 – CIForward Primer CGATGTCTCCGATGCGGTTA71
Reverse Primer GAAGGAGGGATTGGGGTAGC
Cytb – CIIIForward Primer GGCTACGTCCTTCCATGAGG75
Reverse Primer TGGGATGGCTGATAGGAGGT
COX1 – CIVForward Primer ATCACTACCAGTGCTAGCCG84
Reverse Primer CCTCCAGCGGGATCAAAGAA
ATP6 – CVForward Primer TCCCAATCGTTGTAGCCATCA76
Reverse Primer AGACGGTTGTTGATTAGGCGT
Housekeeping genes
Actb Forward Primer AGAAGCTGTGCTATGTTGCTCTA91
Reverse Primer TCAGGCAGCTCATAGCTCTTC
  • Actb, beta actin; Drp1, dynamic‐related protein 1; Fis1, fission 1; Mfn, dynamin‐related GTPase termed mitofusin; Atp6, ATP synthase 6; Co 1, mitochondria‐encoded cytochrome c oxidase, COX1; Cytb, mitochondria‐encoded cytochrome B; CypD, peptidylprolyl isomerase D; Nd1, mitochondria‐encoded NADH dehydrogenase 1; Nd5, mitochondrial NADH dehydrogenase 5; Nrf, nuclear respiratory factor; Opa1, Optic atrophy protein 1; Ppargc1a, peroxisome proliferator‐activated receptor gamma coactivator 1‐ alpha; Tfam, mitochondrial transcription factor A.